Skip to main content

Advertisement

Table 1 Primer sequences used for qPCR analysis

From: In vivo evaluation of two tissue transglutaminase PET tracers in an orthotopic tumour xenograft model

Gene NCBI reference sequence Forward (5′→3′) Reverse (3′→5′) Amplicon size (base pairs)
GAPDH NM_002046.3 TCAAGGGCATCCTGGGCTAC CGTCAAAGGTGGAGGAGTGG 81
TGM1 NM_000359.2 CAATGTCTCAGGCCACGTC CCAGTAACGTGAGGGAGAGG 95
TGM2 NM_004613.2 AGAGGAGCGGCAGGAGTATG AGGATCCCATCTTCAAACTGC 111
TGM3 NM_003245.3 AACCTGAAGATCGACGTGC CAGTTGCTTGGTGCCACTC 93
TGM5 NM_201631.3 TCCTGGTGAACAAGATCATC GTATGGAGAGTGGCTGGTTC 90
F13A1 NM_000129.3 TCCGCAGAGGGCAGTCTTTC CCTGTGGGTAGCGACCAATGA 105